T3 RNA Polymerase, HC (≥100 U/μL)
Inquire about OEM or Commercial Supply version of this product here.
T3 RNA Polymerase, HC (≥100 U/μL)
Thermo Scientific™

T3 RNA Polymerase, HC (≥100 U/μL)

Thermo Scientific Bacteriophage T3 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. ItRead more
Have Questions?
Catalog number EP0103
Price (USD)
378.00
Each
Add to cart
Request bulk or custom format
Price (USD)
378.00
Each
Add to cart
Thermo Scientific Bacteriophage T3 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter and is able to incorporate modified nucleotide.

Highlights

Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Note

Consensus promoter sequence:
T3: AATTAACCCTCACTAAAGGGAGA
The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3 are critical for transcription, and they must be a G and a purine base, respectively.
For Research Use Only. Not for use in diagnostic procedures.
Specifications
PolymeraseT3 RNA Polymerase
Quantity10,000 U
Concentration200U/µL
Unit SizeEach